consider the following sequence:
5' CACCATCGTCAGTTATCGCCAAGC 3'
3' GTGGTAGCAGTCAATAGCGGTTCG 5'
write the sequence of two hexamer (six-nucleotide) primers that can be used to amplify via PCR the exact sequence above (the sequence above will be the final PCR product). be sure to designate the 5' and 3' ends.
Tags for this Thread
+ Reply to Thread
Results 1 to 1 of 1
-
10-28-2011, 05:09 AM #1
Junior Member
Status- Offline
Join Date- Jan 2011
Posts- 2
Downloads- 0
Uploads- 0
hexamer primers for PCR URGENT help?
ReplyThread Information
Users Browsing this Thread
There are currently 1 users browsing this thread. (0 members and 1 guests)
Similar Threads
-
During the PCR, why does it take 3 cycles to get an actual copy of the DNA we...
By David in forum Discuss BikingReplies: 0Last Post: 01-27-2011, 04:03 PM -
For PCR gel electrophoresis, how can i tell which sample is homozygous and which is...
By SandyRude in forum Discuss Polls and QuizesReplies: 0Last Post: 05-06-2010, 12:20 PM -
Dependability of PCR testing for HIV?
By Leo Gn in forum Online TestingReplies: 0Last Post: 12-12-2009, 05:08 PM -
PCR Cycles Questions?
By Andy in forum Discuss ScienceReplies: 0Last Post: 02-23-2009, 12:35 AM -
discuss the applications of the PCR technology?
By shoo in forum Discuss Everything LoungeReplies: 1Last Post: 05-20-2008, 07:25 AM
Bookmarks